Healthy Lifestyle

Healthy Lifestyle In a perfect world we would all be  eating the right food,  exercising, sleeping well  and just generally enjoying life. In the real world most of us manage a percentage of the  healthy lifestyle  and muddle through as best we can with the rest of it. Part of the problem is we are encouraged to think, mostly by the media, that we should be doing everything possible towards a healthy lifestyle, all of the time. For most of us this is just not possible. Constant concern about what we should or shouldn't be doing causes our stress levels to go up and that negates any good work that we've done. Yes, we should certainly try for a healthy lifestyle, but the two key words are â€Å"moderation† and â€Å"balance†. By applying these criteria to achieving a healthy lifestyle we won't be beating ourselves up for failing another diet or dropping out of the latest exercise regime. A common mistake that many people make when they decide to adopt a healthy lifestyle is to try to do too much too soon. They then give themselves a guilt complex when it all falls apart. It is also easy to be influenced by others, when we should only be adopting a healthy lifestyle plan to suit ourselves. Ah! Did I say lifestyle plan? Do you have one, or do you just try the next thing that is in your magazine or Sunday supplement? By all means read these articles and take them into account as you  plan how you want your healthy lifestyle to take shape. Leading a healthy lifestyle doesn't mean you have got to run a mile before breakfast, eat seeds and think pure thoughts. Great if that's what you want, but for most of us â€Å"healthy† means being in reasonable shape, eating our fruit and vegetables and generally having a feeling of vitality. Decide on your definition of a healthy lifestyle, and then plan a strategy that works for you. As part of my health plan I decided I wanted to walk in the mornings before breakfast, but there was no way I wanted to get up at the crack of dawn to do it. So I planned a ten minute circuit that includes a short flight of steps and a not too steep incline. I power walked that route every day and felt really good. Sure l wouldn’t make the City to Surf marathon, but I compromised and made it work for me. Today, much is made of organic foods, but the reality is that organic food is generally more expensive and well out of the range for most budgets. Yes organic is probably the best option, but it doesn't mean that if you're not eating all organic you are not eating right. If you're concerned about general produce, be a bit discerning when you shop. Look for fruit and vegetables that are fresh and unblemished. You should also buy product brands that you can trust. If you shop wisely, you can have a well-balanced healthy diet that won't break the bank. Basically living a healthy life means looking at your lifestyle as a whole, it is not just about diet and exercise. It is not always necessary to make major changes. Most people know their weak spots, and are happy if they can make a few changes that show results. A friend of mine was drinking several cans of soft drink a day. She was feeling tired and generally under the weather. When I read an article about the health risk of soft drink I copied it and gave it to her, whereupon she decided to give up the soft drink there and then. A week later she got back to me and said she couldn't believe the difference, her energy levels were up and she was feeling great. Just that one change was able to make a difference and she feels good about the healthy choice. Sleep and leisure time play a big part in a healthy lifestyle,   and for the most part people underestimate the value of good sleep. Our bodies aren’t designed to operate at peak performance twenty four hours a day. Anyone in industry knows that machines that have to work continuously need a lot of maintenance. When we are sleeping our body is healing and regenerating itself and we should wake up feeling refreshed and revitalized. We can go without sleep for extended periods, but we can't do it indefinitely. The amount of sleep an individual needs varies a great deal, and there is no such thing as the right time to sleep. Obviously most people sleep at night, but if you are one of those folk that comes alive in the small hours, you might need to catch up with your sleep during the day. A big part of healthy living is being comfortable with yourself. Don't be pressured into trying to attain a certain look, or push yourself down a career path you are not suited to. Constant worry about what you are doing will only have the opposite effect on your health. Don't get paranoid about your  diet,  about what toothpaste you should use or about expensive exercise equipment you need to buy. Allow a common sense approach to dictate when you are making lifestyle choices, and remember, there is nothing wrong with compromise if it means your healthy lifestyle plan will work for you. Article source : http://www. wellbeing-information. com/article-healthy-lifestyle. html Healthy Lifestyle Healthy Lifestyle In a perfect world we would all be  eating the right food,  exercising, sleeping well  and just generally enjoying life. In the real world most of us manage a percentage of the  healthy lifestyle  and muddle through as best we can with the rest of it. Part of the problem is we are encouraged to think, mostly by the media, that we should be doing everything possible towards a healthy lifestyle, all of the time. For most of us this is just not possible. Constant concern about what we should or shouldn't be doing causes our stress levels to go up and that negates any good work that we've done. Yes, we should certainly try for a healthy lifestyle, but the two key words are â€Å"moderation† and â€Å"balance†. By applying these criteria to achieving a healthy lifestyle we won't be beating ourselves up for failing another diet or dropping out of the latest exercise regime. A common mistake that many people make when they decide to adopt a healthy lifestyle is to try to do too much too soon. They then give themselves a guilt complex when it all falls apart. It is also easy to be influenced by others, when we should only be adopting a healthy lifestyle plan to suit ourselves. Ah! Did I say lifestyle plan? Do you have one, or do you just try the next thing that is in your magazine or Sunday supplement? By all means read these articles and take them into account as you  plan how you want your healthy lifestyle to take shape. Leading a healthy lifestyle doesn't mean you have got to run a mile before breakfast, eat seeds and think pure thoughts. Great if that's what you want, but for most of us â€Å"healthy† means being in reasonable shape, eating our fruit and vegetables and generally having a feeling of vitality. Decide on your definition of a healthy lifestyle, and then plan a strategy that works for you. As part of my health plan I decided I wanted to walk in the mornings before breakfast, but there was no way I wanted to get up at the crack of dawn to do it. So I planned a ten minute circuit that includes a short flight of steps and a not too steep incline. I power walked that route every day and felt really good. Sure l wouldn’t make the City to Surf marathon, but I compromised and made it work for me. Today, much is made of organic foods, but the reality is that organic food is generally more expensive and well out of the range for most budgets. Yes organic is probably the best option, but it doesn't mean that if you're not eating all organic you are not eating right. If you're concerned about general produce, be a bit discerning when you shop. Look for fruit and vegetables that are fresh and unblemished. You should also buy product brands that you can trust. If you shop wisely, you can have a well-balanced healthy diet that won't break the bank. Basically living a healthy life means looking at your lifestyle as a whole, it is not just about diet and exercise. It is not always necessary to make major changes. Most people know their weak spots, and are happy if they can make a few changes that show results. A friend of mine was drinking several cans of soft drink a day. She was feeling tired and generally under the weather. When I read an article about the health risk of soft drink I copied it and gave it to her, whereupon she decided to give up the soft drink there and then. A week later she got back to me and said she couldn't believe the difference, her energy levels were up and she was feeling great. Just that one change was able to make a difference and she feels good about the healthy choice. Sleep and leisure time play a big part in a healthy lifestyle,   and for the most part people underestimate the value of good sleep. Our bodies aren’t designed to operate at peak performance twenty four hours a day. Anyone in industry knows that machines that have to work continuously need a lot of maintenance. When we are sleeping our body is healing and regenerating itself and we should wake up feeling refreshed and revitalized. We can go without sleep for extended periods, but we can't do it indefinitely. The amount of sleep an individual needs varies a great deal, and there is no such thing as the right time to sleep. Obviously most people sleep at night, but if you are one of those folk that comes alive in the small hours, you might need to catch up with your sleep during the day. A big part of healthy living is being comfortable with yourself. Don't be pressured into trying to attain a certain look, or push yourself down a career path you are not suited to. Constant worry about what you are doing will only have the opposite effect on your health. Don't get paranoid about your  diet,  about what toothpaste you should use or about expensive exercise equipment you need to buy. Allow a common sense approach to dictate when you are making lifestyle choices, and remember, there is nothing wrong with compromise if it means your healthy lifestyle plan will work for you. Article source : http://www. wellbeing-information. com/article-healthy-lifestyle. html Healthy Lifestyle A healthy diet is one that helps maintain or improve health. It is important for the prevention of many chronic illnesses and other health risks such as: †¢ obesity †¢ heart disease †¢ diabetes †¢ cancer etc A healthy diet involves consuming appropriate amounts of all nutrients, and an adequate amount of water. Nutrients can be obtained from many different foods, so there are a wide variety of diets that may be considered healthy diets. There are a number of diets and recommendations by numerous medical and governmental institutions that are designed to promote certain aspects of health. However the most recommended diet is a BALANCED DIET. This diet is even indorsed and recommended by the World Health Organization A balanced diet is a diet that includes appropriate amount of nutrients especially the five major food groups. These five major food groups have been designed and put on a food pyramid to make it easier to understand. It is made up of †¢ carbohydrates †¢ vitamins and minerals †¢ proteins †¢ sugars and fats †¢ water The problem with eating unhealthy foods is  it makes you crave even more junk food. A  handful of chips usually leave you wanting more. Once you break the cycle of unhealthy eating, it’s easier to maintain good eating habits which lead to weight loss. Junk food includes foods such as hamburgers, hot dogs, ice cream, cake, hot chips and pizza etc Unhealthy food not only makes one prone to more illnesses, but they can slow down a child’s development. Smoking and regular drinking are also unhealthy. Smoking can cause lung and respiratory diseases, loss of memory as well as skin, nail and teeth damage. Drinking on the other hand can cause serious cases of liver damage, blurred vision and one can even become dependent on this substance. I advise you stay away from any drinking and smoking. So, next time when someone offers you a smoke or a drink, rather take a glass of clean and fresh water! Stay safe! 1. Not smoking 2. Healthy weight 3. Eating healthy – minimum 5 vegetables and fruit per day 4. Exercising 30 minutes, 5 times per week 5. Sleeping for at least eight hours The following five countries participated in the global Youth Tobacco Survey: Ghana, Malawi, Nigeria, South Africa, and Zimbabwe (Global Youth Tobacco Survey Collaborative Group 2002). The survey showed a significant number of youths age 13 to 15 smoked cigarettes; many more used other tobacco products. Upper Body Flexibility Exercises Stretch #1 Shoulder & Chest This can be performed kneeling or standing. Clasp hands behind back and straighten arms. Raise hands as high as possible and bend forward from the waist and hold. Stretch #2 Arm Across Chest Place one arm straight across chest. place hand on elbow and pull arm towards chest and hold. Repeat with other arm. Stretch #3 Triceps Stretch Place one hand behind back with elbow in air. Place other hand on elbow and gently pull towards head. Hold and repeat with other arm. [pic] Lower Body Flexibility Exercises Stretch #4 Glute Stretch Sitting on floor with right leg bent, place right foot over left leg. Place left arm over right leg so elbow can be used to push right knee. Hold and repeat for other side. Stretch #5 Adductor Stretch Stand with feet as wide apart as is comfortable. Shift weight to one side as knee bends. Reach towards extended foot and hold. Repeat for other side. Stretch #6 Single Leg Hamstring Place leg out straight and bend the other so your foot is flat into your thigh. Bend forward from the waist keeping your back flat. Hold and repeat with the other leg. Stretch #7 Standing Quadriceps Standing on one leg grab the bottom of one leg (just above ankle). Pull heel into buttocks and push the hips out. Your thigh should be perpendicular to the ground. Hold and repeat with the other leg. Stretch #8 Standing Calf Place feet in front of each other about 18 inches apart. Keep back leg straight and heel on the floor. Push against a wall to increase the stretch. Hold and repeat with other leg. Healthy Lifestyle A healthy diet is one that helps maintain or improve health. It is important for the prevention of many chronic illnesses and other health risks such as: †¢ obesity †¢ heart disease †¢ diabetes †¢ cancer etc A healthy diet involves consuming appropriate amounts of all nutrients, and an adequate amount of water. Nutrients can be obtained from many different foods, so there are a wide variety of diets that may be considered healthy diets. There are a number of diets and recommendations by numerous medical and governmental institutions that are designed to promote certain aspects of health. However the most recommended diet is a BALANCED DIET. This diet is even indorsed and recommended by the World Health Organization A balanced diet is a diet that includes appropriate amount of nutrients especially the five major food groups. These five major food groups have been designed and put on a food pyramid to make it easier to understand. It is made up of †¢ carbohydrates †¢ vitamins and minerals †¢ proteins †¢ sugars and fats †¢ water The problem with eating unhealthy foods is  it makes you crave even more junk food. A  handful of chips usually leave you wanting more. Once you break the cycle of unhealthy eating, it’s easier to maintain good eating habits which lead to weight loss. Junk food includes foods such as hamburgers, hot dogs, ice cream, cake, hot chips and pizza etc Unhealthy food not only makes one prone to more illnesses, but they can slow down a child’s development. Smoking and regular drinking are also unhealthy. Smoking can cause lung and respiratory diseases, loss of memory as well as skin, nail and teeth damage. Drinking on the other hand can cause serious cases of liver damage, blurred vision and one can even become dependent on this substance. I advise you stay away from any drinking and smoking. So, next time when someone offers you a smoke or a drink, rather take a glass of clean and fresh water! Stay safe! 1. Not smoking 2. Healthy weight 3. Eating healthy – minimum 5 vegetables and fruit per day 4. Exercising 30 minutes, 5 times per week 5. Sleeping for at least eight hours The following five countries participated in the global Youth Tobacco Survey: Ghana, Malawi, Nigeria, South Africa, and Zimbabwe (Global Youth Tobacco Survey Collaborative Group 2002). The survey showed a significant number of youths age 13 to 15 smoked cigarettes; many more used other tobacco products. Upper Body Flexibility Exercises Stretch #1 Shoulder & Chest This can be performed kneeling or standing. Clasp hands behind back and straighten arms. Raise hands as high as possible and bend forward from the waist and hold. Stretch #2 Arm Across Chest Place one arm straight across chest. place hand on elbow and pull arm towards chest and hold. Repeat with other arm. Stretch #3 Triceps Stretch Place one hand behind back with elbow in air. Place other hand on elbow and gently pull towards head. Hold and repeat with other arm. [pic] Lower Body Flexibility Exercises Stretch #4 Glute Stretch Sitting on floor with right leg bent, place right foot over left leg. Place left arm over right leg so elbow can be used to push right knee. Hold and repeat for other side. Stretch #5 Adductor Stretch Stand with feet as wide apart as is comfortable. Shift weight to one side as knee bends. Reach towards extended foot and hold. Repeat for other side. Stretch #6 Single Leg Hamstring Place leg out straight and bend the other so your foot is flat into your thigh. Bend forward from the waist keeping your back flat. Hold and repeat with the other leg. Stretch #7 Standing Quadriceps Standing on one leg grab the bottom of one leg (just above ankle). Pull heel into buttocks and push the hips out. Your thigh should be perpendicular to the ground. Hold and repeat with the other leg. Stretch #8 Standing Calf Place feet in front of each other about 18 inches apart. Keep back leg straight and heel on the floor. Push against a wall to increase the stretch. Hold and repeat with other leg. Healthy Lifestyle Healthy Lifestyle In a perfect world we would all be  eating the right food,  exercising, sleeping well  and just generally enjoying life. In the real world most of us manage a percentage of the  healthy lifestyle  and muddle through as best we can with the rest of it. Part of the problem is we are encouraged to think, mostly by the media, that we should be doing everything possible towards a healthy lifestyle, all of the time. For most of us this is just not possible. Constant concern about what we should or shouldn't be doing causes our stress levels to go up and that negates any good work that we've done. Yes, we should certainly try for a healthy lifestyle, but the two key words are â€Å"moderation† and â€Å"balance†. By applying these criteria to achieving a healthy lifestyle we won't be beating ourselves up for failing another diet or dropping out of the latest exercise regime. A common mistake that many people make when they decide to adopt a healthy lifestyle is to try to do too much too soon. They then give themselves a guilt complex when it all falls apart. It is also easy to be influenced by others, when we should only be adopting a healthy lifestyle plan to suit ourselves. Ah! Did I say lifestyle plan? Do you have one, or do you just try the next thing that is in your magazine or Sunday supplement? By all means read these articles and take them into account as you  plan how you want your healthy lifestyle to take shape. Leading a healthy lifestyle doesn't mean you have got to run a mile before breakfast, eat seeds and think pure thoughts. Great if that's what you want, but for most of us â€Å"healthy† means being in reasonable shape, eating our fruit and vegetables and generally having a feeling of vitality. Decide on your definition of a healthy lifestyle, and then plan a strategy that works for you. As part of my health plan I decided I wanted to walk in the mornings before breakfast, but there was no way I wanted to get up at the crack of dawn to do it. So I planned a ten minute circuit that includes a short flight of steps and a not too steep incline. I power walked that route every day and felt really good. Sure l wouldn’t make the City to Surf marathon, but I compromised and made it work for me. Today, much is made of organic foods, but the reality is that organic food is generally more expensive and well out of the range for most budgets. Yes organic is probably the best option, but it doesn't mean that if you're not eating all organic you are not eating right. If you're concerned about general produce, be a bit discerning when you shop. Look for fruit and vegetables that are fresh and unblemished. You should also buy product brands that you can trust. If you shop wisely, you can have a well-balanced healthy diet that won't break the bank. Basically living a healthy life means looking at your lifestyle as a whole, it is not just about diet and exercise. It is not always necessary to make major changes. Most people know their weak spots, and are happy if they can make a few changes that show results. A friend of mine was drinking several cans of soft drink a day. She was feeling tired and generally under the weather. When I read an article about the health risk of soft drink I copied it and gave it to her, whereupon she decided to give up the soft drink there and then. A week later she got back to me and said she couldn't believe the difference, her energy levels were up and she was feeling great. Just that one change was able to make a difference and she feels good about the healthy choice. Sleep and leisure time play a big part in a healthy lifestyle,   and for the most part people underestimate the value of good sleep. Our bodies aren’t designed to operate at peak performance twenty four hours a day. Anyone in industry knows that machines that have to work continuously need a lot of maintenance. When we are sleeping our body is healing and regenerating itself and we should wake up feeling refreshed and revitalized. We can go without sleep for extended periods, but we can't do it indefinitely. The amount of sleep an individual needs varies a great deal, and there is no such thing as the right time to sleep. Obviously most people sleep at night, but if you are one of those folk that comes alive in the small hours, you might need to catch up with your sleep during the day. A big part of healthy living is being comfortable with yourself. Don't be pressured into trying to attain a certain look, or push yourself down a career path you are not suited to. Constant worry about what you are doing will only have the opposite effect on your health. Don't get paranoid about your  diet,  about what toothpaste you should use or about expensive exercise equipment you need to buy. Allow a common sense approach to dictate when you are making lifestyle choices, and remember, there is nothing wrong with compromise if it means your healthy lifestyle plan will work for you. Article source : http://www. wellbeing-information. com/article-healthy-lifestyle. html Healthy Lifestyle A healthy diet is one that helps maintain or improve health. It is important for the prevention of many chronic illnesses and other health risks such as: †¢ obesity †¢ heart disease †¢ diabetes †¢ cancer etc A healthy diet involves consuming appropriate amounts of all nutrients, and an adequate amount of water. Nutrients can be obtained from many different foods, so there are a wide variety of diets that may be considered healthy diets. There are a number of diets and recommendations by numerous medical and governmental institutions that are designed to promote certain aspects of health. However the most recommended diet is a BALANCED DIET. This diet is even indorsed and recommended by the World Health Organization A balanced diet is a diet that includes appropriate amount of nutrients especially the five major food groups. These five major food groups have been designed and put on a food pyramid to make it easier to understand. It is made up of †¢ carbohydrates †¢ vitamins and minerals †¢ proteins †¢ sugars and fats †¢ water The problem with eating unhealthy foods is  it makes you crave even more junk food. A  handful of chips usually leave you wanting more. Once you break the cycle of unhealthy eating, it’s easier to maintain good eating habits which lead to weight loss. Junk food includes foods such as hamburgers, hot dogs, ice cream, cake, hot chips and pizza etc Unhealthy food not only makes one prone to more illnesses, but they can slow down a child’s development. Smoking and regular drinking are also unhealthy. Smoking can cause lung and respiratory diseases, loss of memory as well as skin, nail and teeth damage. Drinking on the other hand can cause serious cases of liver damage, blurred vision and one can even become dependent on this substance. I advise you stay away from any drinking and smoking. So, next time when someone offers you a smoke or a drink, rather take a glass of clean and fresh water! Stay safe! 1. Not smoking 2. Healthy weight 3. Eating healthy – minimum 5 vegetables and fruit per day 4. Exercising 30 minutes, 5 times per week 5. Sleeping for at least eight hours The following five countries participated in the global Youth Tobacco Survey: Ghana, Malawi, Nigeria, South Africa, and Zimbabwe (Global Youth Tobacco Survey Collaborative Group 2002). The survey showed a significant number of youths age 13 to 15 smoked cigarettes; many more used other tobacco products. Upper Body Flexibility Exercises Stretch #1 Shoulder & Chest This can be performed kneeling or standing. Clasp hands behind back and straighten arms. Raise hands as high as possible and bend forward from the waist and hold. Stretch #2 Arm Across Chest Place one arm straight across chest. place hand on elbow and pull arm towards chest and hold. Repeat with other arm. Stretch #3 Triceps Stretch Place one hand behind back with elbow in air. Place other hand on elbow and gently pull towards head. Hold and repeat with other arm. [pic] Lower Body Flexibility Exercises Stretch #4 Glute Stretch Sitting on floor with right leg bent, place right foot over left leg. Place left arm over right leg so elbow can be used to push right knee. Hold and repeat for other side. Stretch #5 Adductor Stretch Stand with feet as wide apart as is comfortable. Shift weight to one side as knee bends. Reach towards extended foot and hold. Repeat for other side. Stretch #6 Single Leg Hamstring Place leg out straight and bend the other so your foot is flat into your thigh. Bend forward from the waist keeping your back flat. Hold and repeat with the other leg. Stretch #7 Standing Quadriceps Standing on one leg grab the bottom of one leg (just above ankle). Pull heel into buttocks and push the hips out. Your thigh should be perpendicular to the ground. Hold and repeat with the other leg. Stretch #8 Standing Calf Place feet in front of each other about 18 inches apart. Keep back leg straight and heel on the floor. Push against a wall to increase the stretch. Hold and repeat with other leg.

Finding the Ratio of Mole of Reactants in a Chemical Reaction

Title: Finding the Ratio of Mole of Reactants in a Chemical Reaction Purpose of Lab: To find the coefficients of two chemical reactants that appears in a balanced chemical equation using the continuous variations method. Pre Lab Questions: 1. 2AgNO3(aq) + K2CrO4(aq) > 2KNO3(aq) + Ag2CrO4(s) 2. There is enough to make a valid conclusion because, on the graph, one can clearly see that the two lines intersect. Thus, one can also determine the mole ratio. The mole ratio is approximately 2:1 (AgNO? to K? Cr? ). Procedure: 1.Obtain 175mL of the bleach solution in a clean 400mL beaker and 175mL of Solution B in another beaker. 2. Measure the temperature of both solutions and record. The solutions should be the same temperature. If they are not, you will need to make a correction for the temperature difference. 3. Using a clean 10mL graduated cylinder, measure 5. 0m: of NaClO and pour the solution into a Styrofoam cup. Using a clean 50mL graduated cylinder, measure 45. 0mL of Solution B and add this to the Styrofoam cup. 4. Stir with a thermometer, and record the maximum temperature reached of the final solution in your data table. . Pour the solution out, rinse the cup and thermometer, and repeat steps 1-4 using a different ratio of the two substances, always keeping the volume at 50. 0mL. 6. Continue testing various ratios until you have at least three measurements on each side of the one that gave the greatest temperature difference. 7. Plot your data on a graph, ? T ? vs. Reactant volume (mL). 8. Draw two best fit straight lines, and determine where they intersect. Be sure to include the points at the 0:50mL and 50:0mL rations. If at any points do not fall close to the lines, repeat these measurements.Find the stoichiometric mole ration of reactants from the line of intersection on the graph. Data: Initial Temp of both: 23. 5? Na2SO3 (mL)| NaClO(mL)| Max. Temp. (? )| 45. 0mL| 5. 0mL| 28. 9? | 5. 0mL| 45. 0mL| 27. 5? | 25. 0mL| 25. 0mL| 42. 3? | 40. 0mL| 10. 0mL| 33 . 4? | 10. 0mL| 40. 0mL| 30. 9? | 30. 0mL| 20. 0mL| 43. 5? | 20. 0mL| 30. 0mL| 38. 6? | Conclusion: In this lab we found the coefficients of two chemical reactants that appeared in a balanced chemical equation using the continuous variations method. The mole ratio turned out to be 1:1.One can be able to find the correct mole ratio after plotting the results on a graph that showed the trend of change in temperature. Theory: The theory of this experiment was continuous variation because it gives the stoichiometric ratios for the correct chemical equation if one does them correctly. Error Analysis: Instead of keeping just one initial temperature for all the tests, to make it more accurate, we could have measured the initial temperature of the solutions before each reaction. The exactness of the thermometer could have altered our results. Related essay: Measuring Reaction Rate Using Volume of Gas Produced LabAlso, there was an error in measuring the reactants using graduated cylinders. This most likely happened because graduated cylinders are not the most accurate way to measure a liquid. Post Lab Questions: 1. Different temperature changes occur when mixing different volumes of the two reactants. The experiment was made so the volume of solution and the total number of moles of reactants was a constant for all of  experiments, since temperature change was directly proportional to the amount of reactants. Therefore, the optimum ratio is the ratio of the volume of reactants.It consumed the greatest amount of reactants, formed the greatest amount of products, and generated the most heat and maximum temperature change 2. A constant volume of reactants must be kept in all trials so that the subsequent changes in temperature can be compared. They are proportional to the amount of reactants consumed in the reaction. 3. Ye s. The concentrations of  the two solutions must be the same in order for the stoichiometric mole ratio of the reactants to be accurate after the results of the trial are graphed because molar  concentration is moles of solute divided by liter of solution. . A limiting reagent is reactants in a chemical reaction that will be completely gone before all other reactants in the reaction are used up. This will also cause the reaction to stop. 5. Both measurements limit the precision of the data. The measurement of temperature limits the precision of the data to 3 significant figures. The thermometer used was able to be read to the tenths of a degree. On the other hand, the measurement of  volume limits the precision of the data to 2 significant figures.The graduated cylinders used, only could measure volume to the nearest mL and anything after that was an estimate. 6. The limiting reagent along the upward sloping line of the graph is Na? SO?. The limiting reagent along the downward slope line is NaClO. 7. Other physical properties that could be used in the method of continuous variation, besides temperature change, could be color change, the mass of a precipitate that forms, and/or the volume of a gas produced. 8.It is more accurate to use the point of intersection of the two lines to find the mole ratio rather than the ratio associated with the greater temperature change because one most likely did not use the exact mole ratio. Thus, the point of intersection is a more likely an average. Also, the maximum amount of each reactant might not have been used to get the highest temperature; the highest temp wouldn't necessarily have the highest mole to more ratios. 9. The average of the temperatures would be used as the initial temperature.Graph: Calculations: The intersection point was at approximately 28. 6 mL Na? SO3? and 21. 4 mL NaClO. Moles Na? SO3? = 0. 5 M(. 0286 L) = . 0143 moles Na? SO3? Moles NaClO = 0. 5 M(. 0214 L) = . 0107 moles NaClO .0143 moles Na? SO3? /. 0107 = 1. 34 moles Na? SO3? which rounds to the nearest whole number, 1 . 0107 moles NaClO/. 0107 = 1 mole NaClO The stoichiometric mole ratio is 1:1 for the reactants. The actual stoichiometric mole ratio for the reaction is 1:1.

Crumbs bakeshop Assignment Example | Topics and Well Written Essays - 500 words

Crumbs bakeshop - Assignment Example Due to this philosophy Crumbs Bake Shop is successfully increasing its customers and is becoming a respected and recognized brand of US. Marketing Strategy of Crumbs Bake Shop consist on internet, radio, television and newspaper advertisement along with in-store efforts. Crumbs invests sufficient amount of money for its promotion, brand differentiation, and brand recognition. Crumbs believes that it is the leader in the market of gourmet cupcakes and makes every possible steps to market itself as perfect store of choice for delicious and attractive cupcakes (Randazzo, 2014). CULTURE: USA is a multicultural state but all its cultures love baked products and this is one of the reasons of Crumbs Bake Shop’s success. People of US likes delicious backed products of Crumbs Bake Shop and by fulfilling customers’ demands the company is successfully growing. SOCIETY: The western society is food loving society especially backed food. The society demands cupcakes and other bakery items and Crumbs Bake Shop knows how to meet customers’ changing demands (Moyer, and  Sullivan, 2014). High consumption of bakery food by US’s society creates more opportunities for Crumbs Bake Shop. One of the greatest strengths of Crumbs Bake Shop is its wide variety of cupcakes. It offers more than 50 different types of cupcakes to its customers (Peterson, 2014). The irresistible and delicious items in its menu delight customers and are one of the main reasons for customer retention. Another strength of Crumbs is its online availability; anyone can buy cupcakes from Crumbs Bake shop online. The major weakness of the company is its limited cash reserves. A growing food chain requires extensive amount of money to meet the expenses but unavailability of cash creates problems for the company. Increasing of too many retail shops within short time period and poor management policies are also a weakness

From Typical Contracts to E-Contracts Assignment

From Typical Contracts to E-Contracts - Assignment Example Therefore it is advantageous as it saves both consumers the time they would have used to travel to the signing offices. Third, the technology has greatly improved efficiency in the real estate sector hence resulting to reduce â€Å"contract-to-closing times.† Also, the electronic contract system reduces deforestation. This is because it has eliminated the use of papers for documentation. Instead, it uses CD’s where the signed documents are stored and issued to the consumers. In addition, the new procedures favor consumers who do not like to reveal their identity. This is because there is no eye contact between the buyer and seller. The only person who gets to meet the consumers is the attorney thus providing privacy to those who value their personal privacy. From the 1st classmate, I would agree with him that it feels different while closing deals through electronic system compared with the traditional way. Despite the difference in two methods, both need much attention as a way of maintaining accuracy. By using this method, consumers risk losing nothing since they are guaranteed protection from the real estate companies. None of their protection will be jeopardized in electronic contracts since all procedures are done in private. To the 2nd classmate, I think you should end the doubts you have towards the e-contract system. It is true people rarely read the whole contract but with the use of e-contracts, one can read them faster than reading hard copies . The search and find tools make all the difference thereby making the transactions easy and transparent. In addition to this, conditions precedent adhere to thereby the whole procedure is done under the discharge performance rule. By this, it means that the completion of the consumers’ contract can only be done through following what was promised before the signing of that contract.

Lesson Plan Analysis Essay Example | Topics and Well Written Essays - 500 words

Lesson Plan Analysis - Essay Example They start connecting to what they already know and prepare themselves to process new information; as well it encourages them to begin to formulate correct responses in L2. In assessing this part of the plan, students are evaluated as to active participation in the discussion, ability to comprehend and interpret new idioms by responding correctly to discussion questions and the general flow of the discussion, and their degree of peer engagement in L2. Provide alternative learning outcomes by revising the expectations and reducing the number of expectations. (p.260) By reading some selections aloud to students, it models pronunciation and helps students develop a feel for rhythm and intonation of English sentences. ( p.222) It is important for all teachers to guide students through texts, demonstrating effective reading strategies and focusing on specific text. This teacher-directed intensive reading known as â€Å"guided reading†; it helps students develop strategies that they can use to read independently challenging texts.

Common core Research Paper Example | Topics and Well Written Essays - 2000 words

Common core - Research Paper Example On the other hand, the Common core standard initiative conflicts the teachers instructional training that the teachers received during their teaching preparation training. This makes it difficult for the teachers to adjust to the new instructional requirement under the Common core standard (Sewall, 2014). Thus, this discussion seeks to assess the dangers that the Common core standard of education presents to children. The issue was selected because it is a nationwide concern for all educational stakeholders; parents, teachers, students and the employers have issues related to the overall impact of the introduction of the Common core standard on the high school graduate abilities and skills to cope with the requirements of the outside world (Exstrom & Thatcher, 2014). The discussion will first define the Common core standard problem, and then venture into the analysis of the available literature and studies that have explored the need, justification, benefits and dangers posed by the educational initiative to the students. Finally, the discussion will conclude with giving the suggestion for improvement. However, it can easily be concluded that the Common core standard poses some educational danger to school children. The need to adapt to the global working environment cannot be ignored at this time and age where globalization has made it essential for employment preparation and training to be shaped such that it does not only suit the local environment, but also the global working environment (Rycik, 2014). Thus, the establishment of the Common Core State Standards (CCSS) was a necessary move towards aligning the elementary and the high school education in the United States to match with the college education and the work expectations of the top performing countries globally (Boslaugh, 2014). Thus, the students were required to undergo the learning and

Computer Coursework Example | Topics and Well Written Essays - 1500 words

Computer - Coursework Example The digital computer operations are done by logic circuits that are digital circuits. The outputs of such circuits can be regulated by the input conditions. The many processing data within the interior of the computer ought to work in a synchronized way. This is often achieved by regulating them with a steady oscillator that always acts as the oscillator. The CPU is the main storage unit of the computer and sometimes can be referred to as the computer’s memory. Initially, it consisted of vacuum tubes, but later consisted of ferromagnetic cores with doughnut shapes. Data and programs are not always used in the main storage and can always be stored in secondary or auxiliary storage. While punched paper cards have this function, the main materials that are currently in use include flash disks, magnetic tape and flash memories. When compared to the RAM, these are quite cheap. Today, magnetic tape is used mainly for the storage of voluminous data or main backups. In optical and magnetic systems, the norm is similar. The disk drive also has a motor that can spin the optical head. The drives are designed in a number of forms (Knuth, 2003, p.69).  The flash disks have nonvolatile memory, which can be reprogrammed or erased. The central processing Unit (CPU): The circuitry and the motherboard must be powered. The CPU acts as the thinking process or the computer brains just like humans have their brains to process and relay information. The processors usually have a cooling unit that helps in reducing the heat within the computer. The computer usually gives its user all the necessary instructions during operation. The common processors have quad-cores (Knuth, 2003, p.76).  The modern computers have at least two CPUs, which help in the power of processing and to optimize the potential. The power supply: Just like humans need the energy to operate, the computers also need the power to operate. The energy

The Difference Between What is Known and What is Believed Essay

The Difference Between What is Known and What is Believed - Essay Example For one, it occurs logical to acknowledge the truth that she loves me because I am her daughter, her offspring above all. We cannot deny the biological fact that we are related by blood and we share certain traits by genetic transfer so that this evidence altogether constitutes a scientific basis for the natural loving bond between us. Moreover, I should recognize that my mother truly loves me because she had religiously managed serious domestic efforts all through my childhood days. That includes the typical obligation which every other good mother fulfills such as providing for me a safe and comfortable shelter, cooking and cleaning for the household which I am a regular member of, preparing my needs for school, and attending to me diligently for relief from sickness. Besides all this knowledge, I can further attest to the belief that my mother loves me as I constantly sense her affectionate concern. With my mother’s demonstration of concern comes the presence of warmth whic h is something that I could not readily observe as present and spontaneous from my experience of other people’s help approach. ... ter how excruciating, nevertheless, she had endured pains of labor and delivery not only to allow me to live but even to sustain my living in a considerable span of time so that it convinces me to perceive her natural motherly inclination as an utmost manifestation of a more profound level of desire, which is love. As another empirical evidence, I notice that while others exhibit their concern by spending time with me in difficult situations, they often do so yet merely to some extent unlike my mother who would stay and never leave my side until my troubles are all over. Not only does my mother go with me an extra mile, she is sensible enough to feel my specific needs even if they are indirectly conveyed to her understanding. Upon thorough examination of the aforementioned evidences by reason of logic and perception out of experience, I still maintain the claim that knowledge of the material world must hold according to physical evidence. However, love is immaterial though we have ge nerally accepted its truth and this appears to be an exception because the reasons that speak of love cannot help being enhanced and supported by a number of experiences beyond thought. Apparently, these empirical accounts seem to be in harmony with logic where logic alone bears no more capacity of proving how love may be viewed in a material context. I am but a human being who is normally accustomed to associating read or spoken ideas to tangible images of things in order to gain knowledge of the world in which case, it is inevitable to make use of our senses. By seeing, hearing, smelling, or touching concrete objects in repeated patterns over time, we are able to figure what exists and identify it based on color, shape, size, and other essential characteristics. It is part of our nature

Carbon Emission Abatement Essay Example for Free

Carbon Emission Abatement Essay Topic: Carbon emission abatement can be achieved by various meaner, for example, regulation (controlling the emitting of carbon on the same basis as governments control other pollutants), by subsidizing consumption of renewable technologies using wind or the sun, by subsidizing non-carbon polluting technologies and by supporting research into innovative green technologies. Another way of achieving reduction in carbon emissions is a pricing scheme such as a cap-and-trade emissions trading scheme (TEST), which could exist in Australia by 2014, and China probably by 2015. Nations have also achieved reductions through energy conservation. Discuss (1) the various options available for carbon abatement, their merits and weaknesses, and (2) the role government and business have to play if the methods are to achieve their objectives. Major Assignment Tutor: Mrs. Maintained Sings Major Assignment Global warming is a complicated issue faced by leaders of today. Warnings are becoming increasingly amplified, in the wake of a realization that a disastrous future ahead because of the perpetual accumulation anthropogenic greenhouse gases ? emanating from fossil-fuel combustion and burning forests. PM Tony Blair told BBC sews that scientific evidence of global warming was overwhelming and its consequences disastrous. Global warming is the observed increase in the average temperature (f the Earths atmosphere and corners in recent decades (Brakeman 2009). The Earths average near-surface atmospheric temperature increased by 0. 6 ? ± 0. 2 Celsius (1. 1 ? ± 0. 4 Fahrenheit) in the 20th century (The Universe-Galaxy-stars 2012). Global warming and climate change have already unleashed untold suffering to thousands of people across the face of the earth. Think of the millions of environmental refugees who have been forced to vacate the land of their forefathers cause of flooding. Thousands of children in Africa have been born into lives of poverty, disease and famine, resulting from shifting climatic conditions (Andorra 2011, quoted in Africa Up in Smoke, 2012, 12). In Niger for example, drought and famine claimed the lives of nearly 70 people (BBC News 2012), whilst later in the year, unexpected flooding displaced 1 50000 families, stirred up a cholera outbreak and claimed more lives. In Australia and the US, wild raging fires have destroyed the habitat of thousands of species, reducing beautiful vast carpets of green thriving tit flora and fauna; into barren lifeless stretches of sparsely vegetated, stunted and horrid landscapes with little biodiversity. Moderate to exceptional, whilst intensified convection over the Caribbean also brought heavy rains to Colombia, where flooding displaced an estimated 1. 5 million people. Thousands of pages can be authored to document the incalculable grave impacts global warming has caused to our beloved mother earth. It is even more astonishing when you realism that all this anguish has been borne by people who are now alive today. You cannot help but wonder what it shall be like in the more distant true. A continued surge in co levels for another century will see gases reach a level unheard of since millions of years ago. The consequences are anticipated to take many centuries to be fully manifested, as the Earth transforms into a new state. In the distant future, eras with high CO are anticipated where sea levels will be even higher and temperature will soar to catastrophic levels: a planet grossly unlike the one to which the human species is adapted (Conservation Foundation 1963). By now you may be wondering , what is the link between Global Warming and Carbon Emissions? After all, the essence of this account is a mere review of the various meaner by which Carbon Emissions may be reduced. Scientific research has established a link between Global Warming and Carbon Dioxide pollution. Carbon dioxide particles are capable of retaining heat energy received from the sun (Rogers 1989). The atmosphere naturally contains optimum levels of carbon dioxide, necessary to make the earth habitable (green-house effect). Human activities such as burning of forests and fossil fuels, however, further append co levels in the atmosphere to catastrophic levels which cause global warming and climate change (Munroe 2011). The author was inclined to explain the relationship between Carbon emission and Global Warming, so as to express the weight of the Carbon Reduction issue under review. Mitigating carbon emission seeks to curb Global Warming and all its adverse impacts highlighted previously. Global warming is the bigger picture beyond carbon emission. Carbon reduction methods in the discussion essentially target the sectors summarized the opposite pie-chart. Government can use regulation to reduce carbon emission levels. This is essentially a command-and-control approach, where standard minimum requirements are established and enforced by law. Such laws may target annual level of carbon emission, mandatory adoption of given forms of clean technology and production techniques. Compliance by emitters is mandatory, the failure of which is punishable by fines, public shaming, penalties, sanctions and blacklisting. (ESSAY Emission. Trading 2010). Regulation is an effective control mechanism as it covers all aspects of the global emission by sector. Regulation almost guarantees a reduction, as companies seek to and static, that it fails to allow firms to determine a cost saving approach, based on the elimination of non-value adding costs and the most efficient course of action elevate to the industry (ESSAY Emissions trading 2010). Low volume, small industries such as dry cleaners and book printers, for example; may feel aggrieved when their carbon assessment is made on the same basis as that of mega profit making high volume industries such as oil and gas extraction or car manufacturers. The smaller industries are sure to comply with the legal requirement concerning carbon emissions in the fear of being penalized substantially. The bigger industries however, may find the penalties very negligible in comparison to the high revenues they generate. This sad tale ensures that small companies remain small, whilst the bigger industries continue to grow. As mentioned by Parry (2004, 35), regulation when used to dictate capital injection towards a given technology or production technique; is criticized for being efficient than substitute alternatives available. Presently, the fines for breaking the EX. carbon law is pegged at 100 euros ($130) per metric ton (1 . 1023 tons) of carbon, for airline companies and 7 euros per metric tones for general manufacturing industries (ESSAY Emissions trading 2010). As stated by Paltrier (2010, 13), laws against the carrying out of deforestation are another form of regulation that target carbon emission reduction. Deforestation is the unwarranted cutting down of trees for logging, mining, oil and gas extraction; cattle ranching or agricultural purposes. You may have wondered, if at all any linkage exists between trees and carbon. How do laws against deforestation achieve carbon reduction? You will be glad to know that trees act as a carbon sink, absorbing carbon dioxide in the atmosphere. The presence of trees creates a carbon sink which eliminates to greater extent, the excess levels of carbon. When this mechanism however is eliminated, then how will atmospheric carbon subside? The absence of trees would cause an unprecedented exponential growth in Carbon levels. However it is saddening to note that most of the damage has been done already. Did you know that between 1930 and today, Philippines has lost 90% of its rainforests, whilst Madagascar has lost 95% of its rainforests, El Salvador 70-85% of its rainforests due to heavy bombing during the civil war 1984-1985. Sumatra has only 15% of its rainforests left. It appears that substantial damage has been done already, yet still, governments cannot afford to waver in the fight to curb deforestation. It is encouraging to note that some governments have even taken a pro-active approach to not only protect their few remaining forests, but to replenish the depleted ones also. Issues of economic development hinder the effective implementation of deforestation laws. Imagine the impact of halting logging activities in Africa, which are providing employment for millions of people and putting food on the table in thousands of homes. What about the grave effect on their already beset economies; what would it mean for initiatives such as building schools, educating and empowering women on family planning and many other crucial issues? Resultantly, it is no surprise that only 6% of Central Africans forests are protected by law (Laurence et al 2006, 457). Service, to ensure efficiency and marginal carbon emission from the combustion of fuel. Other regulations, such as the U. S Lacey Act 1968, bar the trade of wooden products across international boundaries. The role of government is to provide adequate funding for the effective implementation of these laws and of course to enact the legislation to curb carbon emission (Greenback 2011). Another way of reducing carbon emission as stated by Festoon (10, 4) is the rewarding of development of renewable technologies using wind or the solar energy. The truth of the matter is that, it is relatively costlier in the early years to develop clean technologies. Setup costs are high and most companies are discouraged. However, rewarding the development and use of such technologies would provide incentive for companies to partake. Such reward can be in the form of government subsidy to lower acquisition costs of setup material, the provision of expert engineers to assist in the setup activity, offering loans to clean technology development projects as well as a mere sign of recognition and appreciation. The government will obviously need to cater for these requirements in its national budget. The government is also tasked with rendering support for research into innovative green technologies. The subsidy approach is highly viable as it provides incentive for businesses to develop cleaner technologies, whilst the companys liquidity and cash flow remain relatively unaltered. This entails that companies will continue to enjoy healthy profits whilst, developing cleaner technologies concurrently, or in the case of government loans; spreading the cost of the financing activity which will be eventually offset by rower operating costs in the long run. This approach also ensures a healthy mutually beneficial relationship between the government and business. One drawback however, is that once companies attain such loans, they may not be used entirely to serve the purpose of clean technology development. In Zanzibar, for example, cases have been recorded whereby; some farmers misused loans rendered to them by the Ministry of Agriculture through Agro-Bank, for the purpose of developing wind vanes (Mutagen 2012). Furthermore, resources are not always sufficient enough to provide for this cause. Carbon emission may also be reduced through a federally-imposed carbon tax (Ovenbird 1997). The main idea is that government can use the surplus tax revenue to finance subsidies in the development of selected low-carbon technologies. The chances of any government imposing a new tax however, is somewhere between zero and nil. If carbon is taxed, this will significantly decrease annual profits, repel investors and cause economic recession. The successful imposition of carbon tax would entail that governments possess a whole new pool of subsidy revenue to distribute to industry. Will the tax revenue be used to provide subsidies for clean genealogy development? If at all subsidies are indeed issued, would you trust that they will award them to the right companies, foot the right reason? It is a really a be the most effective strategy? Naked (2003:11) revealed that in Japan, a carbon tax rate of $2. 0/mm Btu case produced an emission rate of 324 mm ETC in the year 2040, attaining a 23% reduction in the emission rate. Without carbon tax imposition however, CO emission in 2040 would be 420 mm ETC (2003) . Without tax return in this case, CO emission rises to 332 mm ETC, producing an 8 mm ETC production compared with the tax return case. Clearly carbon tax, though controversial, can bring the results. Pricing schemes such like the cap-and-trade emissions trading scheme (TEST) can reduce co (Hessian 14,349). The role of government in this case is to set the ground rules. Its role is restricted, and major decisions are made in the private sector. The government establishes an overall emissions cap and assigns specific emissions allocations to the different sources of CO. Industries and companies are free to decide as to what to do or how to meet their allocations. The government needs to engage experts of industry, to come up with a reasonable maximum amount f carbon emission for various respective industries. Furthermore, the government is tasked with providing an accurate and reliable meaner of carbon emission measurement. Furthermore, there is also need to engage with other relevant bodies such as the EX., AU or SEAN. In the case of the European Union member countries for example, governments ought to work together in the implementation of cap-and- trade schemes. The two vital components of cap-and-trade schemes is the cap itself, and its flexibility that allows companies to exchange emissions warrants. The cap is perimeter of carbon emissions imposed by the TEST. The cap is attained by the creation of emissions permits, supplemented by a business requirement for emitters to yield the amount of permits equivalent to their carbon emissions, traditionally on an annual basis. Under an TEST any firm emitting carbon under the permissible perimeter may retain permits equivalent to the amount of its carbon emission, whilst the excess permits may be sold. Presently, carbon permits can be traded at 7 euros a metric ton. Permit price fluctuates according to market volatility, whilst the cap (maximum permissible amount of carbon emission) is fixed. The buying and selling of carbon remits is the second vital aspect of cap-and-trade schemes. One major advantage is that companies can implement carbon abatement at a lower cost than compared to the permit price for excess emissions. This ensures that companies will purchase permits, only when the cost of reducing its emissions surpasses that the purchasing price of permits. Emissions reductions will therefore be attained at the lowest cost to the economy and society at large. Other advantages include the following; predictable annual carbon emissions which allow for economic and carbon forecasting, relatively lesser political barriers than a tax, government can generate venue which can be reinvested through rebates or utilized to provide public goods such as roads and street lighting and companies generate revenue as carbon emissions decline. Cap-and-trade successfully reduced the sulfur oxide emissions that cause acid rain, quickly and cheaply (Roberts 2012) Critics argue that, whilst total carbon emissions are capped the monetary worth thereof remains unspecified as it is determined by several market variables. This meaner that some economic conditions result in a marginal price for permits, which does not provide sufficient incentive for companies to limit their carbon emissions ND sell the excess permits. Another scenario may also occur, where, the market conditions result in a very high price which exceeds that of reducing carbon emissions. The scope and manner of price setting may also result in too many permits may be issued which gives rise to other market imperfections. Industrial nations must reduce their dependence on fossil fuels such as gasoline, oil, and coal as they produce carbon dioxide, a heat-trapping gas that causes global- warming. Industrial countries are liable for most of the worldwide carbon emissions. These countries however, are capable of switching to cutting-edge energy saving cosmologies that produce marginal carbon emissions. Clean, renewable sources, such as solar, wind, and hydro-electricity, can generate sufficient energy without increasing carbon emission (Blackmore 1998). Such technologies need to be deployed much more widely, whilst government policies must encourage their use. Investment should also be directed towards developing and commercialisms clean technologies. The Australian Government for example, invested more than $5 billion in clean energy technologies development since 2000. Such technologies are vital efforts to reduce carbon emissions. (Department of Climate Change and Energy Efficiency) As stated by Dawson (1987,16), transferring Clean Technology to Developing Countries is also necessary for carbon reduction. Leading businesses, international organizations, and the Medics ought to devise a meaner to transfer energy saving technologies to Leads. This enables Leads to develop their economies without using environmentally unfriendly fossil fuel technologies which the Medics are now striving to phase out. As pollution knows no boundaries, it is vital for all world governments to reduce carbon emission. However, this creates a dependency syndrome, where poor countries over-rely on richer countries. African leaders for example, have been criticized for living lavishly, yet failing to bring about economic growth in their countries, which leaves their citizens to survive on donations from Medics and Nos. The government must also initiate behavior change. This can be done through awareness campaigns, media advertising as well as communicated in schools and work places. Did you know that cars, trucks, and buses consume over half of the oil consumed in the United States (Wellhead 2010)? Imagine the impact of substituting traditional vehicles with energy efficient gasoline-powered cars, electric and fuel-cell ears and buses. These measures will lessen CO emissions by using less gasoline. In addition, campaigns may also encourage consumers to make less trips (encourage walking for small errands), use of public transportation, bicycles, and carpools. If we use less energy, less carbon dioxide is produced. Over the past two decades, American industry and consumers started using more-efficient motors, vehicles, appliances, windows, and manufacturing processes. Vast amounts energy and money promote energy efficient products. (Graph showing natural gas reduction of oil reliance- Centre for American Progress 2012) Governments must also slow down population growth, through awareness, family planning, women emancipation and free distribution of contraceptives. Whilst all the aforementioned technological and economic changes can reduce per capita carbon emissions, persistent large population increases will retard emission reduction efforts. The more people there are, the more energy is required. Reducing population growth rate will alleviate carbon reduction efforts. Reducing carbon emission is not an event that can be completed over night; but a process which needs several years to bring fourth results.

What A Higher Education Means To Me Essay Example for Free

What A Higher Education Means To Me Essay As a military officer working with the United States of America’s Air Force, a higher education means a lot to me. The United States of America’s Air Force mission is to deliver sovereign options in a bid to offer defence to the nation and serve other global interest. It is the youngest of the U. S Armed Force’s branches and it was created in 1947. The United States of America Air Force flies and fights in air, space and in cyberspace. The US Air Force’s vision is global vigilance reach and power (Sandra, 2004) As a military officer, furthering my education is very crucial since it will prepare me effectively to effect the air force’s vision of keeping vigil for the globe, reaching other globes as well as exercising power and force of the United States of America’s Air Force. Going for further studies means advancing my knowledge and skills. In today’s globalized world, the United States of America’s Air Force officers need to be more knowledgeable so as to be in a position to offer effective service in today’s highly demanding, challenging and complex globe. Higher Education implies that I will gain more technical knowledge and skills. Global vigilance is very demanding and there is no way an Air Force officer can keep watch, day and night on a globe which he does not have adequate knowledge and information on its economic, political and social aspects. Thus, pursuing further studies on politics of other nations will prepare me in knowing what to expect. For instance, when the United States of America’s Air force is expected to spy on dealings of say a neighbouring or a terrorist nation, prior knowledge and information on the given nation is very crucial since it helps the officers be in a position to detect strange or unexpected behaviour or operations of the nation. This will make it easy for the military officers to make decisions on whether to attack the nation or not. Thus, decisions to advance education for military officers in the united states of America’s Air Force has been met by a lot of support (Sandra, 2004) Many Air Force officers have developed a desire to advance their education. Furthering one’s education by enrolling for studies in an institution of higher learning implies that the Air Force officers will also advance their careers, which means offering effective service to the community. In most institutions of higher learning for Air Force officers, language studies and cultural studies have been focused at service academics. These studies are very crucial in that there is no way United States of America’s Air Force officers can communicate to other officers across the globe without the use of language. A higher education also means that I will be more effective and will deliver recommendable service to the United States Air Force, the United States nation and the whole globe. Effective service implies that my seniors i. e. the Chief Master sergeant of the Air Force or the Air Force chief of staff will recognize my good work. Continued appraisals, acknowledgements and rewards will mean that my seniors may decide to reward my efforts and determination my giving me a promotion which will mean a lot to me. Various awards by the Air Force secretary will also help boost my self-esteem and motivate me to perform better. In today’s’ globalised world, the United States of America’s Air Force and any other nation need further education so as to be able to move with advancements and progresses in the use of Information Communication Technology (ICT). Further education plays the role of equipping me with upto date discoveries in the field of technology. In addition, further education can assist me in carrying out research and survey on various issues affecting the United States of America’s Air Force and any other Air Force bases across the globe. For instance, carrying out research on the use of alternative sources of fuel in the United States of America’s military force. In conclusion, higher education is very crucial for the United States of America’s Air Force and any other air force or military force across the globe in effecting their goals and missions. People should change their perceptions that going for further studies is a waste of resources and time for the Air Force officers. Higher education is the key to effective service. Reference Donovan (2004) The U. S Air Force, Lerner publications (23-27)

Encoding RIP from Elaeis Guaneensis Jacq

Encoding RIP from Elaeis Guaneensis Jacq Detection and expression profiling of two novel transcripts encoding RIP from Elaeis guaneensis Jacq. in Ganoderma boninense interaction 1. Introduction Among several oil-producing plants, oil palm (Elaeis guineensis) is a tropical crop which is exclusively grown for oil production. Its high oil yield is extracted from oil palm’s thick fleshy mesocarp which is extremely rich in oil (80% of dry mass). Furthermore, oil palm has the highest oil production (oil per unit land) compared to other oil-producing plants. The extracted oil has been used widely for several applications including, food, cosmetics, and bio-fuel (Paterson 2007; Murphy 2009; Alizadeh et al. 2013). Among various diseases , the basal stem rot (BSR) is known to be the most serious disease in oil palm (Ho and Nawawi 1985). Furthermore, the BSR is caused by Ganoderma boninense which is considered specifically as a â€Å"white rot fungus†. The lignin is broken by the fungus leaving whitish cellulose exposed (Paterson 2007). The infection process is initiated when the oil palm roots are penetrated by fungal mycelia, which is spread out to the stem bole, after which the trunk eventually collapses (Rees et al. 2009). Malaysia and Indonesia have suffered the most severe losses from the BSR; furthermore, the diseases has been identified in Malaysia several decades ago (Ho and Nawawi 1985; Idris et al. 2004; Rees et al. 2007). Oil palms of different genetic origins have shown to have resistance to BSR. However, the genes involved in the resistance of oil palms against G. Boninense were unknown (Idris et al. 2004; Durand-Gasselin et al. 2005). Recently, few defence related genes were identified in oil palm. The major pathogen on oil palm in Malaysia has been identified as G. boninense Pat. Stem rots of oil palm caused by species of Ganoderma are a major threat to the sustainability of the oil palm production. In this study, we have isolated one cDNA encoding RIP’s EST, from oil palm. Its expression in oil palm root infected by G. boninese; was investigated to shed light on its potential involvement during early disease development. 2. Materials and methods 2.1 Sample preparation A total of 24 six-month-old oil palm seedlings (Elaeis guineensis Jacq., DxP, GH500 series) were purchased from Sime Darby Plantation Sdn. Bhd. (Banting Malaysia) and divided into two groups with 12 seedlings in each group, one of these groups were treated with Ganoderma boninense Pat. Strain PER71, while the remaining group served as controls. Seedlings treated with G.boninense were inoculated by sitting each seedling on rubber woodblock fully grown with G.boninense PER71 while the other group of seedlings were inoculated with fungal surface mulch as described by (Alizadeh et al., 2011). Three biological replicates of the seedlings were harvested from each treatment at 4, 8, 12 wpi, respectively. The leaves, roots and stem cell were frozen in liquid nitrogen and stored at -80 °C (Tan et al., 2013). 2.2 RNA extraction Total RNA was extracted from treated and untreated oil palm root tissues using a modified CTAB method briefly, 0.1 g tissue was ground in liquid nitrogen into a very find powder. The powder was immediately transferred into 1.5 ml extraction CTAB buffer [ 2% (w/v) cetyl trimethyl ammonium bromide, CTAB; 100mM Tris-HCl, pH 8.0; 2M NaCl; 25 mM ethylenediamineteraacetic acid, EDTA; pH 8.0; 2% (w/v) polyvinylpyrrolidone, PVP; and 2% (v/v) ÃŽ ²-mercaptoethanool]. Equal volume of chloroform/isoamylalcohol (24:1, v/v) was added into the tube and centrifuged at 12,857 g for 15 min at 4 °C. The upper layer was transferred into a new tube and equal volume of phenol/chloroform/isoamylalcohol (25:24:1, v/v/v) was added and centrifuged. This step was repeated until a clear supernatant was obtained. The supernatant was adjusted to a final concentration of 2M LiCl, and incubated at 4 °C for overnight, and then centrifuged. The RNA was dissolved in 5ml diethypyrocarbonate (DEPC) – treated water. An equal volume of chloroform/isoamylalcohol was added, mixed, and centrifuged at 12,857 for 30 min at 4 °C. Precipitation of RNA was performed by adding 0.1 vol of 3M sodium acetate (pH 5.2), 2 vol 100% ethanol and incubated at -80 °C for overnight. After centrifugation, the pellet was washed using 70% ethanol and dissolved in 20ul DEPC-treated water. The quality of RNA was examined by using a Nanodrop( BioRad) at 230, 260 and 280 nm. The RNA integrity was examined using 1.5% agarose gel electrophoresis. The RNA was treated with DNase I (Qiagen, USA) following the manufacturer’s instructions. Figure : Total RNA from various treated and untreated oil palm tissues. Lane A: Untreated control seedling. Lane B: Treated seedlings. 1) Leaf. 2) Basal stem. 3) Root 3. Semi-quantitative Reverse transcriptase (RT-) PCR 3.1 Isolation of cDNA Omniscript â„ ¢ Reverse Transcriptase kit (Qiagen Kit) was used for cDNA synthesis by the following kit manuscript. To obtain the sequence of cDNA from oil palm, gene specific primers were designed based on oil palm expressed sequence tag (EST) (Ho, 2010) and RIP’s type I alignments, using primer 3 version 0.4.0(frodo.wi.mit.edu). 3.2 Sequence analysis of cDNA Semi-quantitative Reverse transcriptase (RT-) PCR was performed on EST using PCR machine with Reverse transcriptase enzyme. Equal amounts of RNA (1ug) extracted from control and treated oil palm root samples were converted into cDNA by using the Omniscript two step Reverse Transcription Kit for cDNA Synthesis (Qiagen, USA) following the manufacturer’s instructions. The resulted sequences shown significant similarities to RIP (Naher et al., 2011). 3.3 Expression profiling Expression levels were calculated by Quantity One 1-D Analysis software 4.6.5 (Bio-Rad) according to the manufacturer’s instructions. PCR products were resolved on 1.5%(w/v) agarose gel (1xTAE) with a DNA mass standard marker (MassRuler TM DNA Ladder, Fermentas). The density of the DNA mass standard dilution series was used to generate calibration curve for absolute quantisation of sample bands by linear regression with extrapolation to zero for each experiment. The density of each sample band was then converted to an absolute quantity using the calibration curve. For each sample band was then converted to an absolute quantity using the calibration curve. For each experiment, the relative band quantity obtained by densitometrric analysis was normalized to the value of the internal control (house-keeping gene) bands which were run in parallel. Identification of differentially expressed genes was based on consistent ford-change across experimental replicates relative to untreate d negative control. Fold changes of ≠¥2- fold or ≠¤0.5-fold were considered as significant. 3.4 Statistical analysis A one-way analysis of variance (ANOVA) was used to determine statistical differences (SPSS version 17;SPSS Inc., Chicago, IL). When the ANOVA was significant at P 0.05 the Duncan’s multiple range test was used for means comparison. The t-test was used to compare between group means.(Alizadeh et al., 2011) 4. Results 4.1 sequence analysis EgRIP-1b The partial cDNA of EgRIP-1b (Dr. Ho personal comment) encodes a putative type I ribosome inactivating protein. The partial sequence consists 167 nucleotide residues. (Fig. 2). This sequence has the highest identity with RIP type I from Populus trichocarpa (98%, XP_002328056.1), Hordeum vulgare (90%, AAA32951.1) and Chain A, Structure Of Mutant Rip From Barley Seeds (90%, 4FBA_A). The NODE_77734GT was classified in a RIP-like superfamily. A putative conserved domain of catalytic residues and some RIP family domain were in this sequence, including that it is a member of the RIP superfamily.(Fig. 5) (Naher et al., 2011) M I C E S I R F E R I S E F L A T E F P G S S K P P K TGATGATCTGCGAGTCGATTAGATTCGAACGCATCTCCGAATTTCTTGCTACCGAATTCCCCGGCAGTTCGAAACCCCCTAAA W M P A L E H G W G D L S A A L L R A D A N P D R P F TGGATGCCGGCACTCGAGCACGGCTGGGGAGATCTCTTTGCCGCGTTGCTGCGCGCCGATGCCAATCCCGACCGTCCCTTCA Fig. 2. The nucleotide and deduced amino acid sequences of NODE_77734GT. 4.2 sequence analysis EgRIP-1a The partial cDNA sequence EgRIP-1a (GenBank ID: ) encodes a protein of 17 amino acid. The sequence consists 178 nucleotides (Fig. 3). This sequences has the highest identity with other type I RIPs from Nicotiana tabacum (47%, ABY71831.1), Musa acuminate (47%, ABY71832.1), Alocasia macrorrhizos (47%, ABY71829.1), Agave sisalana (47%, ABY71828.1) (Fig. 6.a) and (Fig. 6.b) M R P T P N F H Y E W S A CAGGATTCCAGCCGAGCTCCTGCGATAGCCGAACTTCTACCACATGCGACCTACTCCAAACTTCCACTACGAGTGGTCTGCTC L S K Q TCTCCAAACAA Fig. 3. The nucleotide and deduced amino acid sequences of EgRIP-1a. Fig. 4: multiple alignment of NODE with other type I RIPs. Amino acid residues that are identical in all sequences are highlighted in black while amino acid residues that are highly conserved are highlighted in gray; dashes represent gaps introduced to maximize the alignment. (a) (b) Fig. 5: Multiple alignment of EgRIP-1a with other RIPs. The protein sequences and their accession numbers used for analysis of detected sequence. a) Nucleotide residues that are highly conserved are highlighted in gray; dashes represent gaps introduced to maximize the alignment. b) Amino acid residues that are identical in all sequences are highlighted in black with amino acid residues that are highly conserved are highlighted in gray; dashes represent gaps introduced to maximize the alignment. 4.3 Expression profiles (of RIP) in oil palm root upon Ganoderma inoculation A total of 2 cDNA sequences encoding putative defence-related proteins from oil palm were chosen for gene expression profiling in this study. A relative semi-quantification of EgRIP-1b and EgRIP-1b transcripts were performed by calibrating the expression of each gene with an endogenous control, actin. Fig.6 Shows the relative expression level of EgRIP-1b in roots and basal stems in response to the inoculation of G. boninense at different time points compared with that of negative control plants. In G. boninense-treated plants, the gene expression of EgRIP-1b in oil palm roots at 2 wpi was induced. The expression level were n- and n-fold of the uninfected root tissues at 8 and 12 wpi, respectively.(Naher et al., 2011) The expression level was studied in 3 replication of each sample, there were no significant (P>0.05) differences in expression levels in inoculated plants (Alizadeh et al., 2011). EgRIP-1a was up-regulated n-fold and n-fold at X wpi, respectively; before the transcript level decrease at Y wpi in oil palm root tissue following G.boninense infection (Fig). EgRIP-1a expression level were m-, m- and m-fold of the uninfected basal stem tissues at 2,4, 8 and 12 wpi, respectively. EgRIP-1b and EgRIP-1a were not expressed in time zero, untreated samples and leaf tissues. (I) diseased (II) healthy (a) (b) (c) Fig. 6. Differential expression of EgRIP-1b in variety tissues in response to I) G.boninese treatment compare to those in II )control.. a) root tissue, b) stem cell tissue, c) standard (Rippmann et al., 1997) a) b) Fig. 7. Expression level mean in each biological replicate a) in root; b) in stem (I) diseased (II) healthy (a) (b) (c) Fig. 8. Differential expression of EgRIP-1a in variety tissues in response to I) G.boninese treatment compare to those in II) control.. a) root tissue, b) stem cell tissue, c) leaf tissue d)control (Rippmann et al., 1997) a) b) Fig. 9. Expression level mean in each biological replicate a) in root; b) in stem Fig. 10. Semi-quantification of oil palm EgRIP-1a and EgRIP-1b expression levels in root tissues at 2-12 week after inoculation with G.boninense. Significant up-regulation of gene expression compared to untreated negative control. References Alizadeh F, Abdullah SNA, Chong PP, Selamat A Bin (2013) Expression Analysis of Fatty Acid Biosynthetic Pathway Genes during Interactions of Oil Palm (Elaeis guineensis Jacq.) with the Pathogenic Ganoderma boninense and Symbiotic Trichoderma harzianum Fungal Organisms. Plant Molecular Biology Reporter. doi: 10.1007/s11105-013-0595-y Durand-Gasselin T, Asmady H, Flori a, et al. (2005) Possible sources of genetic resistance in oil palm (Elaeis guineensis Jacq.) to basal stem rot caused by Ganoderma boninenseprospects for future breeding. Mycopathologia 159:93–100. doi: 10.1007/s11046-004-4429-1 Ho YW, Nawawi A (1985) Ganoderma boninense Pat . from Basal Stem Rot of Oil Palm ( Elaeis guineensis ) in Peninsular Malaysia. Pertanika 8:425–428. Idris AS, Kushairi A, Ismail S, Ariffin D (2004) SELECTION FOR PARTIAL RESISTANCE IN OIL PALM PROGENIES TO Ganoderma BASAL STEM ROT. Journal of Oil Palm Research 16:12–18. Murphy DJ (2009) Oil palm: future prospects for yield and quality improvements. Lipid Technology 21:257–260. doi: 10.1002/lite.200900067 Paterson R (2007) Ganoderma disease of oil palm—A white rot perspective necessary for integrated control. Crop Protection. doi: 10.1016/j.cropro.2006.11.009 pilotti CA (2005) Stem rots of oil palm caused by Ganoderma boninense: Pathogen biology and epidemiology. Mycopathologia 159:129–137. Rees RW, Flood J, Hasan Y, et al. (2009) Basal stem rot of oil palm ( Elaeis guineensis ); mode of root infection and lower stem invasion by Ganoderma boninense. Plant Pathology 58:982–989. doi: 10.1111/j.1365-3059.2009.02100.x Rees RW, Flood J, Hasan Y, Cooper RM (2007) Effects of inoculum potential, shading and soil temperature on root infection of oil palm seedlings by the basal stem rot pathogen Ganoderma boninense. Plant Pathology. doi: 10.1111/j.1365-3059.2007.01621.x Tan Y-C, Yeoh K-A, Wong M-Y, Ho C-L (2013) Expression profiles of putative defence-related proteins in oil palm (Elaeis guineensis) colonized by Ganoderma boninense. Journal of plant physiology. doi: 10.1016/j.jplph.2013.05.009

Management Control Systems Essays -- Business Controlling Function

There are many different types of control that can be established in an organization depending on its goals and objectives. There are many different approaches to the management controlling function. Some of these control systems are bureaucratic control, market control and clan control. All of these control systems focuses on a different part of the business depend ending the necessities of the organization in that moment. All of the control systems have their advantages and disadvantages.   Ã‚  Ã‚  Ã‚  Ã‚  The controlling function is defined as any process that directs the activities of individuals toward the achievement of organizational goals*. The controlling function is the one that set the game rules. This function set the organizational standards rules and norms. The controlling function works hand to hand with the planning function because the controls are the ones that ensure that the plans are fulfilled. The established controls must go in coherence with the plans because the success of each will depend on the other. The control function not only control the personnel it also control things as , budget, organizational resources, machinery, materials or components, physical structure and more. The control process must set performance standards, measure performance, compare performance with the standards; and take corrective action if needed in order to be effective   Ã‚  Ã‚  Ã‚  Ã‚  One of the most used control systems is the bureaucratic control system. The bureaucratic control system Bureaucratic control is defined as the use of rules, regulations, and formal authority to guide performance*. The bureaucratic control system is a very rigid and formal one. This system establishes a well defined set of rules and procedures in order to achieve the organizational goals and objectives. This system is based on hierarchy were roles and authority has been well defined. This control system involves personnel close monitoring, supervision and direction of subordinates by superiors. The bureaucratic control different uses tools as budget as a control device, management audits, external audits, and internal audits.   Ã‚  Ã‚  Ã‚  Ã‚  The market control system is based on the use of pricing mechanisms and economic information to regulate activities within organizations*. This control system is based in external factors that affects an organization rather than the internal factors.   ... ...n reaction of the implementation of this system. This tactical behavior is defined as the beating the system behavior. This can be harmful to an organization because employees can start to report false information. This will have bad consequences to the organization because it will provide wrong information for the forecasting and planning of future organizational goals and objectives.   Ã‚  Ã‚  Ã‚  Ã‚  Controlling can also produce a resistance to control reaction because Control systems usually uncover mistakes, threaten people’s job security and status, and decrease people’s autonomy it can also change the organizational structures and the authority chain of command. It can also disrupt the social relations of a group.   Ã‚  Ã‚  Ã‚  Ã‚  In order to develop a system functional system for an organization the best decision is to make a hybrid one. Not only taking the organizational objectives in consideration but also taking in consideration the employees and the external and internal factors that affects all of the organization. References Bateman-Snell: Management: The NewCompetitive Landscape,Sixth Edition chapter 16 James Higgins, The Management Challenge, Second Edition, Macmillan, 1994

Addressing Unethical Behavior in the Criminal Justice System Essay

To understand the ethical challenges in the criminal justice system, I took a look at the three parts of criminal justice, Policing, Courts, and Corrections. In doing so I found that this is quite a large topic. The areas I would like to touch on are; those areas in which the newly hired police officer, lawyer, and corrections officer my face. Having only the training he/she was given in their respective academy’s or in the case of attorneys Law School, and with the Oath of office they had just sworn to, hopefully still in, and the men and women they are placed with to guide them; above all their own sense of ethical behavior and morality. Ethics is a very personal thing; it means many things to many people. There is the mind set of â€Å"do unto others as you would have done to you†, the golden Rule, most of us learned early on in life. But as we go through life we start to get our own sense of ethical and moral behavior. We see others acting in a manner in which we would like to act, and wonder how to become more like that person, more times than not, this starts with a parent or sibling, or close family friend. At this early time we are developing our ideas of right and wrong, as well as healthy and unhealthy behaviors. Another area in which some are given a great deal of their ethical and moral values are religion, there is always a reward for doing the right thing, and a punishment for the wrong. Ethics and morality go hand in hand. The ethical and moral values we gather in the early stage of life stay with us though out our adult life. This is where the training in ethics and morality stops. For most of us we go on to live good l... ... solemn oath has a long lasting history, and is held in high regard by many, but few know its meaning. "A solemn affirmation or declaration, made with an appeal to God for truth of what is affirmed. The appeal to God in an oath implies that the person imprecates his vengeance and renounces his favor if the declaration is false, or if the declaration is a promise, the person invokes the vengeance of God if he should fail to fulfill it. A false oath is called perjury."(Webster Dictionary 1828) Works Cited Dr. Frank Kardasz â€Å"Ethics Training For Law Enforcement: Practices and Trends. (2008) Saarbrucken, Germany: VDM Verlag Richard W. De Shon â€Å" Police officer’s Oath of Office a Question of Knowledge† Eastern Michigan University. March 31, 2000 Available at: http://www.emich.edu/cerns/downloads/papers/PoliceStaff/Unsorted/OATH%20&%20ETHICS.pdf

Support individuals during the last days of life Essay

The psychological aspects are different for each person it depends how they react to the thought of a person dying, some people may feel that it’s their own fault or that they have done something wrong taking the blame for it or someone may feel as if their being useless and feel like there’s things that can be done to help but in actual fact there isn’t. In the person’s last days if known others may like to spend a lot of time with the person but others may not want to see them like that and just want to have the better memories as people can’t handle seeing the person looking very frail as this cannot be very nice, but it all depends on how each person can handle the situation and it is also hard as you don’t know whether to expect the worst each time you go into their room as they could have passed away. It can cause a lot of stress within the home setting and people will be very sad but we have to do our best to try and keep them as happy and as calm as they can be. Common signs of approaching death, you can never know when someone is going to die but there is always a sign such as they May- Lose their appetite the person may begin to resist or refuse to eat meals or any drink fluids. Become very fatigue or sleepy- The person may begin to sleep the majority of the day and night as metabolism slows and the decline in food and water contribute to dehydration. Physical weakness- As the person is declining food and sleeping a lot they will find that they have no energy. Confusion or disorientation- Organs begin to fail including the brain they may start to forget where they are or what they are doing. Change in breathing- Breath intakes and exhales can become very irregular. Social withdrawal- As the body starts to shut down they may gradually lose interest in being around those that are close to them. Swelling in feet and ankles- Coolness in tips of fingers and toes. Good end of life care helps patients with life-limiting conditions to live as well as possible until they die, and to die with dignity. End of life care encompasses palliative care, which focuses on managing pain and other distressing symptoms, providing psychological, social and spiritual support to the patients, and supporting those that are close to the patient. All patients should be treated with dignity and respect throughout the course of their care. Patients who are dying must receive the same standard of care as  all other patients. Their privacy, dignity and wishes must be respected at all times, by listening and achieving their wishes can make them feel more relaxed and less distressed. Making sure your patient has good pain relief, making sure they are always comfortable, having other people around them to keep them occupied or even little things like listening to the radio or watching television if they enjoy doing this. Making sure your patient has everything and every one they need around them, some people may not want to be like this some people may want to go alone and this needs to be respected even if their family members or loved ones want to be with them you have to respect the fact they want to be alone as long as they are comfortable. There are rules governing when life-prolonging treatment can be withheld or withdrawn when the patient’s consent is not available, the relatives and friends of the person receiving the treatment and the healthcare professionals in charge of the person’s care, should decide whether treatment should be continued or not. They should consider whether the treatment is in the best interests of the client in terms of quality of life and how long they will live and if the treatment is helping to improve their condition. If the patient still has the capacity to decide whether or not they want to carry on or stop with the treatment it is their own choice as they still have the capacity to their rights. Also it needs to be remembered that the client should always be center of the care. Some of the signs that death has occurred are they- Have stopped breathing No heartbeat Loss of bowel and bladder control No response Eyelids slightly open Eyes fixed on a certain spot Mouth slightly open The body cools When a client does become to near the end of life or even ill from the start you have to work with other professionals at first you may start with the GP to diagnose the patient and they would then refer them to the hospital if required if not they would give you prescriptions for the right medication  to treat them. You would also work with district nurses if required if a client had a bed sore. You would work with the pharmacy to make sure you receive all the medication and on time and to order when needed. A patient should be monitored regularly; everything that the patient does should be recorded and documented correctly making sure they are legible, accurate, relevant and clear. Things that may get monitored- Food intake charts Fluid intake Charts Continence checks Positioning Chart Checking Temperature Body maps to mark if they have any bed sores If they were in pain or how much pain. Some people may not be able to tell you how much or if they are in pain so in some care homes they use pain rating scales, Faces tool, Disability distress assessment tool (DisDat), Body charts/ Maps or its even suggested if the patient is able to keep a pain diary. Everyone approaching the end of life should have their needs assessed and their wishes and any preferences discussed, any actions reflecting their choices they make about the care they would like to receive should all be recorded in their own personal care plan especially as some people in advance want to refuse treatment, the care plan should be regularly reviewed. Once a client enters into the dying phase the care providers need to adapt their care and support according to the care plan, also the client may have a preferred place of death which they had discussed in their care plan this should be reviewed to make sure the care providers are aware. Advanced care planning should be completed as it gives people the opportunity to make their wishes and preferences known should they deteriorate and lose the mental capacity to make informed choices. When a client’s needs change we make sure all staff and any other professionals are aware and know fully of all the changes and any requirements or adjustments that need to be made such as ways of working, making sure all changes are documented in their personal care plan, in staff communication books, also making sure that all risk assessments are updated, reviewed and changed as needed. Making sure the client has everything that they need to meet their needs to the changes. This also helps everyone to  follow the same way of working to support the client when any changes do happen. Some family members/carers may wish to assist with the personal care in acknowledgement of individual wishes, religious or cultural requirements. If it is down to the staff to carry out this task then the Staff should be Prepared before they do this as there are changes to the body after death and they should also be aware of manual handling and infection control issues. Some people may not want their family or staff to do so, once the patient has died you should refer to their plan of care to see and follow their wishes if any after death. In private nursing homes the personal care after death is the responsibility of a registered nurse, although this and the packing of the property may be delegated to a trained healthcare assistant. The registered nurse is responsible for correctly identifying the deceased person and communicating accurately with the mortuary or funeral director (in line with local policy). In care homes without a registered nurse, the home manager is responsible for ensuring that professional carers are trained appropriately and to ensure that they are competent in their role. The death should be documented straight away the time the date and the people that are present, this also has to be reported to the care quality commission within 24 hours. After the persons death the Last offices should be carried out or some people may call it Personal care after death, two members of staff should carry out last offices but this can only be done once the death has been officially confirmed. The staff should wear all protective equipment such as gloves and apron when carrying out last offices. There is a a list of national guidelines, policies and legislations that are required after a death they are – Health and Safety at work act 1974 Control of substances hazardous to health regulations 2002 (COSHH) Code of Conduct Health and social care act 2008 It is always important that the care plan is referred to before after death as the client may have left their wishes and preference that they would like to be carried out and these should always be followed, as the client may have requested that they would not like any family to carry out last offices as this can be distressing for them, they may have requested that their belongings should be given to a charity or some kept with them and many more examples but the point is that their wishes should always be respected and followed. All staff knows and are fully aware that when a client has passed that all procedures in place must be followed when handling the decease and moving their belongings, gloves and aprons must be worn, all of their personal belongings such as bedding, bed cloths and clothing should be disposed of in the correct way. Everyone is different to how they react to somebody passing, there are different types of ways such as- Emotional- Sadness, anger, blame, depression and loneliness. Physical- Weakness in muscles, hollowness in stomach, tightness in throat and shortness of breath. Cognitive- A person may experience mental difficulties, such as poor concentration, forgetfulness and day dreaming. Behavioural- Some people may react by crying, loss of interest and withdrawal. Spiritual- They may start to question their spiritual beliefs but others may find solace. When telling family or friends that their loved one has passed you have to be prepared for different types of reactions as above, people should always be allowed to spend time by the deceased and their privacy should always be respected. Offering a cup of tea and going into a quiet space where they will not be disturbed so that they can talk about what happens next, sometimes people may find it hard to absorb any information so the care staff should write up a simple and clear guide for them. When talking or telling close family or friends you should always use good listening skills show empathy, always make yourself available and give people time to express  themselves and talk, offer any help to register death or organise a funeral or even just offer any advice. In a care setting the rest of the house should be told what has happened and this should not be hidden from them as they all have the right to know, they should all be told in a tactful and sensitive way. Offer support and let them know that staff will always be available if they feel they need to talk. Family or People in a care setting all have the right to be told and known about bereavement support services that are available to them. When a person dies majority or all staff care workers often experience grief, staff can attend the funeral or pay their respects in some way, by attending the funeral this will allow people to express grief and maybe bring closure. People may actively grieve by crying and it is acceptable to cry and let others know that the person will be missed, some people may be tearful or stressed then they should take time out in a quiet area. Talk to others as they might be feeling the same way as you. There is also carer’s support groups that are available that help yourself or staff members to deal with bereavement. You can talk to family or friends, employer, bereavement charities or if this doesn’t help you can get specialist support from your GP.